/*=========================================================================== * * PUBLIC DOMAIN NOTICE * National Center for Biotechnology Information * * This software/database is a "United States Government Work" under the * terms of the United States Copyright Act. It was written as part of * the author's official duties as a United States Government employee and * thus cannot be copyrighted. This software/database is freely available * to the public for use. The National Library of Medicine and the U.S. * Government have not placed any restriction on its use or reproduction. * * Although all reasonable efforts have been taken to ensure the accuracy * and reliability of the software and data, the NLM and the U.S. * Government do not and cannot warrant the performance or results that * may be obtained by using this software or data. The NLM and the U.S. * Government disclaim all warranties, express or implied, including * warranties of performance, merchantability or fitness for any particular * purpose. * * Please cite the author in any work or product based on this material. * * =========================================================================== * */ version 1; include 'vdb/vdb.vschema'; include 'ncbi/sra.vschema'; include 'ncbi/seq.vschema'; include 'ncbi/stats.vschema'; include 'insdc/insdc.vschema'; include 'insdc/sra.vschema'; include 'ncbi/clip.vschema'; include 'sra/454.vschema'; typedef U16 NCBI:usamp1; typedef NCBI:usamp1 NCBI:usamp4 [ 4 ]; physical NCBI:usamp4 NCBI:usamp4_encoding #1.0 { encode { // split into 4 separate streams NCBI:usamp1 ch0 = < NCBI:usamp1 > cut #1 < 0 > ( @ ); NCBI:usamp1 ch1 = < NCBI:usamp1 > cut #1 < 1 > ( @ ); NCBI:usamp1 ch2 = < NCBI:usamp1 > cut #1 < 2 > ( @ ); NCBI:usamp1 ch3 = < NCBI:usamp1 > cut #1 < 3 > ( @ ); I32 ich0 = cast ( ch0 ); I32 ich1 = cast ( ch1 ); I32 ich2 = cast ( ch2 ); I32 ich3 = cast ( ch3 ); I32 ch0d1 = < I32 > deriv ( ich0 ); I32 ch1d1 = < I32 > deriv ( ich1 ); I32 ch2d1 = < I32 > deriv ( ich2 ); I32 ch3d1 = < I32 > deriv ( ich3 ); // compress each stream separately izip_fmt cmp0 = izip ( ch0d1 ); izip_fmt cmp1 = izip ( ch1d1 ); izip_fmt cmp2 = izip ( ch2d1 ); izip_fmt cmp3 = izip ( ch3d1 ); // merge them into a single blob return merge #1 ( cmp0, cmp1, cmp2, cmp3 ); } decode { // split compressed blob into 4 pieces izip_fmt cmp0 = split < 0 > ( @ ); izip_fmt cmp1 = split < 1 > ( @ ); izip_fmt cmp2 = split < 2 > ( @ ); izip_fmt cmp3 = split < 3 > ( @ ); // decompress each piece separately I32 ch0d1 = iunzip ( cmp0 ); I32 ch1d1 = iunzip ( cmp1 ); I32 ch2d1 = iunzip ( cmp2 ); I32 ch3d1 = iunzip ( cmp3 ); I32 ich0 = < I32 > integral ( ch0d1 ); I32 ich1 = < I32 > integral ( ch1d1 ); I32 ich2 = < I32 > integral ( ch2d1 ); I32 ich3 = < I32 > integral ( ch3d1 ); U16 ch0 = cast ( ich0 ); U16 ch1 = cast ( ich1 ); U16 ch2 = cast ( ich2 ); U16 ch3 = cast ( ich3 ); // interleave into single stream return ( NCBI:usamp4 ) < U16 > paste #1 ( ch0, ch1, ch2, ch3 ); } } table NCBI:sra:tbl:trace #1 // declare the table = NCBI:SRA:tbl:sra_nopos #2.1.4 // inherit interface AND implementation for (original) SRA model , NCBI:tbl:base_space #2.0.3 // columns for storing and compressing READ as dna , NCBI:tbl:phred_quality #2.0.4 // columns for storing and compressing QUALITY as phred , NCBI:SRA:tbl:stats #1.2.1 // accumulate statistics upon writing , NCBI:SRA:tbl:clip #1.0.2 // clips { /* PLATFORM * platform name is generically called "capillary" */ ascii platform_name = < ascii > echo < "CAPILLARY" > (); /* // NEEDED: // out_signal (i.e. trace) // trim_len // trim_start // out_spot_group // in_spot_name_tok // out_position (i.e. peak) */ // * // position // position stored as normal 1-based coordinate INSDC:position:one out_position = .POSITION; physical column NCBI:SRA:_454_:encoding:POSITION #2 .POSITION = POSITION; // * // clip_quality_left physical column < INSDC:coord:one > izip_encoding .CLIP_QUALITY_LEFT = CLIP_QUALITY_LEFT; // * // clip_quality_right physical column < INSDC:coord:one > izip_encoding .CLIP_QUALITY_RIGHT = CLIP_QUALITY_RIGHT; // * // clip_vector_left extern column < U32 > izip_encoding CLIP_VECTOR_LEFT; // * // clip_vector_right extern column < U32 > izip_encoding CLIP_VECTOR_RIGHT; // * // trace_name // name of the submission. extern column ascii TRACE_NAME = out_trace_name; ascii in_trace_name = TRACE_NAME; physical column < ascii > zip_encoding .TRACE_NAME = in_trace_name; ascii out_trace_name = .TRACE_NAME; // * // ti extern column < U64 > izip_encoding TI; readonly column U32 ti = cast ( TI ); // * // replaced_by extern column < U64 > izip_encoding REPLACED_BY; readonly column U32 replaced_by = cast ( REPLACED_BY ); // * // submission_id // Field is dictionary from SubmissionType // U16 -> ASCII. Has 15 names like: NEWTRACELESS, TRACELESS, etc // Should be canonized extern column < ascii > zip_encoding SUBMISSION_ID; // * // submission_type extern column < ascii > zip_encoding SUBMISSION_TYPE; // * // chip_design_id // Was added, cuz that value could be added // Mirrored feature_id_file_name extern column < ascii > zip_encoding CHIP_DESIGN_ID; // * // center_name // Field is dictionary from Center // U16 -> ASCII. Has 184 names like: 454MSC, ABC, ABI, AGI, etc extern column < ascii > zip_encoding CENTER_NAME; // * // trace_max_value extern column < U16 > izip_encoding TRACE_MAX_VALUE; // * // trace_format // Field is dictionary from Format // U16 -> ASCII. Has 5 values: SCF, ZTR, AB1, ABI, SFF extern column < ascii > zip_encoding TRACE_FORMAT; // * // source_type // Field is dictionary from Source // U8 -> ASCII. Has 7 values: G, GENOMIC, N, NON GENOMIC, S, // SYNTHETIC, VIRAL RNA extern column < ascii > zip_encoding SOURCE_TYPE; // * // trace_direction // Field is dictionary from Direction // U8 -> ASCII. Has 6 values: F, FORWARD, N, R, REVERSE, UNKNOWN extern column < ascii > zip_encoding TRACE_DIRECTION; // * // trace_end // Field is dictionary from EndId // U8 -> ASCII. Has 6 values: F, FORWARD, N, R, REVERSE, UNKNOWN extern column < ascii > zip_encoding TRACE_END; // * // primer extern column < ascii > zip_encoding PRIMER; // * // strategy // Field is dictionary from Strategy (?) ( wrong size ) // U8 -> ASCII. Has 38 values like: AFLP, BARCODE, CCS, CDNA, etc extern column < ascii > zip_encoding STRATEGY; // * // trace_type_code // Field is dictionary from BlastDump (?) // There are 17 tinyints like: FINISHING, RANDOM, WGS, etc extern column < ascii > zip_encoding TRACE_TYPE_CODE; // * // program_id // Field is dictionary from Program // U16 -> ASCII // There are 1193 values, which looks quite unique, no decriptions extern column < ascii > zip_encoding PROGRAM_ID; // * // template_id extern column < ascii > zip_encoding TEMPLATE_ID; // * // chemistry // Field is dictionary from Chemistry // U16 -> ASCII. Has 60 values, and one of them with id = 4 is "" extern column < ascii > zip_encoding CHEMISTRY; // * // chemistry_type // Field is dictionary from ChemistryType // U16 -> ASCII // Has 3 chemistry types, and 6 names: // 1 { T, TERM, TERMINATOR }, 2 { UNKNOWN }, 3 { P, PRIMER } extern column < ascii > zip_encoding CHEMISTRY_TYPE; // * // flow_chars column INSDC:dna:text FLOW_CHARS = out_flow_chars; INSDC:dna:text in_flow_chars = < INSDC:dna:text, INSDC:dna:text > map < 'acgtn.', 'ACGTNN' > ( FLOW_CHARS ); physical column < INSDC:dna:text > zip_encoding .FLOW_CHARS = in_flow_chars; INSDC:dna:text out_flow_chars = .FLOW_CHARS; // * // key_sequence column INSDC:dna:text KEY_SEQUENCE = out_key_sequence; INSDC:dna:text in_key_sequence = < INSDC:dna:text, INSDC:dna:text > map < 'acgtn.', 'ACGTNN' > ( KEY_SEQUENCE ); physical column < INSDC:dna:text > zip_encoding .KEY_SEQUENCE = in_key_sequence; INSDC:dna:text out_key_sequence = .KEY_SEQUENCE; // * // signal - actual TRACE data column NCBI:usamp4_encoding SIGNAL; //column NCBI:usamp4 SIGNAL; NCBI:usamp4 out_signal = .SIGNAL; // * // attempt extern column < U8 > zip_encoding ATTEMPT; // * // svector_code // Field is dictionary from SeqVector // U16 -> ASCII. Has 230 values like: POT, M13, PUC, POTW13, etc extern column < ascii > zip_encoding SVECTOR_CODE; // * // svector_accession // Field is dictionary from SeqVectorAcc // U16 -> ASCII. Has 8 values like: AF399742, L08752, etc extern column < ascii > zip_encoding SVECTOR_ACCESSION; // * // cvector_code // Field is dictionary from CloneVector // U16 -> ASCII. Has 125 values like: PBACE3.6, PT7T3PAC, PPAC4, etc extern column < ascii > zip_encoding CVECTOR_CODE; // * // cvector_accession // Field is dictionary from CloneVectorAcc // U16 -> ASCII. Has 16 values like: U80929, U13871, U75992, etc extern column < ascii > zip_encoding CVECTOR_ACCESSION; // * // insert_size extern column < U32 > izip_encoding INSERT_SIZE; // * // insert_stdev extern column < U32 > izip_encoding INSERT_STDEV; // * // iteration - it did exists some tiome ago extern column < U16 > izip_encoding ITERATION; // * // plate_id // Field is dictionary from Plate // U32 -> ASCII. Has 7M values like: ML1B-A1156, ML1B-A1158, etc extern column < ascii > zip_encoding PLATE_ID; // * // species_code // Field is dictionary from Species // U32 -> ASCII. Has 12K values like: "ARTIFICIAL SEQUENCE", // "SYNTHETIC", "SYNTHETIC CONSTRUCT", etc extern column < ascii > zip_encoding SPECIES_CODE; // * // organism_name_OLD extern column < ascii > zip_encoding ORGANISM_NAME_OLD; // * // clone_id extern column < ascii > zip_encoding CLONE_ID; // * // chromosome // Field is dictionary from Chromosome // U8 -> ASCII. Has 171 value like: NA, 11, 7, 12, 14, etc extern column < ascii > zip_encoding CHROMOSOME; // * // library_id // Field is dictionary from Library // U16 -> ASCII. Has 11K values like: CH230, RP1, RP11, etc extern column < ascii > zip_encoding LIBRARY_ID; // * // accession extern column < ascii > zip_encoding ACCESSION; // * // run_machine_id // Field is dictionary from Machine // U16 -> ASCII. Has 2K values like: 194, 137, 130, 300, etc extern column < ascii > zip_encoding RUN_MACHINE_ID; // * // run_machine_type // Field is dictionary from MachineType // U16 -> ASCII. Has 160 values like: 194, 137, 130, 300, etc extern column < ascii > zip_encoding RUN_MACHINE_TYPE; // * // run_lane extern column < U16 > izip_encoding RUN_LANE; // * // run_date // smalldatetime extern column < U64 > izip_encoding RUN_DATE; // * // load_date // smalldatetime extern column < U64 > izip_encoding LOAD_DATE; // * // control_flags extern column < U16 > izip_encoding CONTROL_FLAGS; // * // status extern column < U8 > izip_encoding STATUS; // * // seq_lib_id // Field is dictionary from SeqLibrary // U32 -> ASCII. Has 700K values like: 33802, RATBN2.5.2L, etc extern column < ascii > zip_encoding SEQ_LIB_ID; // * // run_group_id // Field is dictionary from RunGroup // U32 -> ASCII. Has 5M values like: 2000-01-24-GEA-D, etc extern column < ascii > zip_encoding RUN_GROUP_ID; // * // update_date // smalldatetime extern column < U64 > izip_encoding UPDATE_DATE; // * // clone_id_list extern column < ascii > zip_encoding CLONE_ID_LIST; // * // extended_data extern column < ascii > zip_encoding EXTENDED_DATA; // * // comments extern column < ascii > zip_encoding COMMENTS; // * // center_project // Field is dictionary from Project // U32 -> ASCII. Has 2M values like: 30153, 31491, 31489, etc extern column < ascii > zip_encoding CENTER_PROJECT; // * // prep_group_id // Field is dictionary from PrepGroup // U32 -> ASCII. Has 3M values like: 6AUG03.842PMAB1, etc extern column < ascii > zip_encoding PREP_GROUP_ID; // * // pmid extern column < U32 > izip_encoding PMID; // * // pick_group_id // Field is dictionary from PickGroup // U32 -> ASCII. Has 1.5M values like: 893877, 895133, etc extern column < ascii > zip_encoding PICK_GROUP_ID; // * // bases_20 extern column < U16 > izip_encoding BASES_20; // * // bases_40 extern column < U16 > izip_encoding BASES_40; // * // bases_60 extern column < U16 > izip_encoding BASES_60; // * // strain // Field is dictionary from Strain // U32 -> ASCII. Has 1.2K values like: KT, SRS30216, LB400, etc extern column < ascii > zip_encoding STRAIN; // * // amplification_forward // Field is dictionary from AmplificationForward // U32 -> ASCII. Has 400K values like: GACGACGAAGACGAAGAAGG, etc extern column < ascii > zip_encoding AMPLIFICATION_FORWARD; // * // amplification_reverse // Field is dictionary from AmplificationReverse // U32 -> ASCII. Has 400K values like: AACTCGCTCCAATGAGGAAA, etc extern column < ascii > zip_encoding AMPLIFICATION_REVERSE; // * // amplification_size extern column < U32 > izip_encoding AMPLIFICATION_SIZE; // * // assembly_id // Field is dictionary from AssemblyId // U32 -> ASCII. Has 2 values: "NCBI BUILD 34", and // "HUMAN BUILD 33, APRIL 2003 FREEZE". extern column < ascii > zip_encoding ASSEMBLY_ID; // * // chromosome_region // Field is dictionary from ChromosomeRegion // U32 -> ASCII. Has 5K values like: "7:26665793-2716579226" extern column < ascii > zip_encoding CHROMOSOME_REGION; // * // hi_filter_size // Field is dictionary from HiFilterSize // U32 -> ASCII. Has 6 values like: "0.1 KD-MICRONS", "0.22", etc extern column < ascii > zip_encoding HI_FILTER_SIZE; // * // lo_filter_size // Field is dictionary from LoFilterSize // U32 -> ASCII. Has 7 values like: "0.0 MICRONS", "0.002", etc extern column < ascii > zip_encoding LO_FILTER_SIZE; // * // environment_type // Field is dictionary from EnvironmentType // U32 -> ASCII. Has 52 values like: "BEACH SAND", // "HUMAN STOOL", "NORTH ATLANTIC DEEP WATER", etc extern column < ascii > zip_encoding ENVIRONMENT_TYPE; // * // host_condition // Field is dictionary from HostCondition // U32 -> ASCII. Has only one value: "HEALTHY" extern column < ascii > zip_encoding HOST_CONDITION; // * // host_id // Field is dictionary from HostIdentifier // U32 -> ASCII. Has 69 values like: 01DBA0010, 01DBA0011, etc extern column < ascii > zip_encoding HOST_ID; // * // host_location // Field is dictionary from HostLocation // U32 -> ASCII. Contains 30 values like: "BELOW CUTICLE", "BONE", // "CECUM", "CORPUS", etc extern column < ascii > zip_encoding HOST_LOCATION; // * // host_species // Field is dictionary from HostSpecies // U32 -> ASCII. Has 11 values like: "ALVINELA POMPEJANA EPIBIONT" // "ESCHRICHTIUS ROBUSTUS", "HOMO NEANDERTHALENSIS", etc extern column < ascii > zip_encoding HOST_SPECIES; // * // individual_id // Field is dictionary from IndividualId // U32 -> ASCII. Has 3M values like: "JDH LADY MANSO 62/4", // "WA-DEL RC BLCKSTR MARTHA-ET (HO-USA 13907649)", etc extern column < ascii > zip_encoding INDIVIDUAL_ID; // * // transposon_acc // Field is dictionary from TransposonAcc // U32 -> ASCII. Has 4 values: "N/A", "NGB00024.2", "", "BD291493" extern column < ascii > zip_encoding TRANSPOSON_ACC; // * // transposon_code // Field is dictionary from TransposonCode // U32 -> ASCII. Has 8 values like: AT-2, EZ-TN, EZ-TN5, etc extern column < ascii > zip_encoding TRANSPOSON_CODE; // * // collection_date // smalldatetime extern column < U64 > izip_encoding COLLECTION_DATE; // * // depth extern column F64 DEPTH; // * // elevation extern column F64 ELEVATION; // * // latitude extern column F64 LATITUDE; // * // longitude extern column F64 LONGITUDE; // * // ph extern column F64 PH; // * // salinity extern column F64 SALINITY; // * // temperature extern column F64 TEMPERATURE; // * // population_id // Field is dictionary from Population // U32 -> ASCII. Has 10 values like: "AFRICAN", "CAUCASIAN", etc extern column < ascii > zip_encoding POPULATION_ID; // * // place_name // Field is dictionary from PlaceName // U32 -> ASCII. Has 82 values like: "HYDROSTATION S, BERMUDA (UK)" extern column < ascii > zip_encoding PLACE_NAME; // * // well_id // Field is dictionary from Well // U32 -> ASCII. Has 300K values like: C6, G9, H2, B5, C11, etc extern column < ascii > zip_encoding WELL_ID; // * // gene_name // Field is dictionary from GeneName // U32 -> ASCII. Has 30K values like: COI, HIF1A, PRKCB1, etc extern column < ascii > zip_encoding GENE_NAME; // * // reference_accession // Field is dictionary from ReferenceAccession // U32 -> ASCII. Has 6K names like: NT_039520.1, NT_039268.1, etc extern column < ascii > zip_encoding REFERENCE_ACCESSION; // * // reference_offset extern column < U32 > izip_encoding REFERENCE_OFFSET; // * // insert_flank_left // Field is dictionary from InsertFlankLeft // U32 -> ASCII. Has 266 values like: AATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGGGGATCCCAC", etc extern column < ascii > zip_encoding INSERT_FLANK_LEFT; // * // insert_flank_right // Field is dictionary from InsertFlankRight // U32 -> ASCII. Has 221 values like: GTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGTATTCTAT, etc extern column < ascii > zip_encoding INSERT_FLANK_RIGHT; // * // reference_acc_min extern column < U32 > izip_encoding REFERENCE_ACC_MIN; // * // reference_acc_max extern column < U32 > izip_encoding REFERENCE_ACC_MAX; // * // feature_id_file_name // Field is dictionary from FeatureIdFile // U32 -> ASCII. Has 4k values like: PSC.CHRN_077.DES33, etc extern column < ascii > zip_encoding FEATURE_ID_FILE_NAME; // * // feature_signal_file_name // Field is dictionary from FeatureSignalFile // U32 -> ASCII. Has only one value: N/A ... lol extern column < ascii > zip_encoding FEATURE_SIGNAL_FILE_NAME; // * // ncbi_project_id // Field is dictionary from ProjectContent // U32 - as is ... there are 188 values extern column < U32 > izip_encoding NCBI_PROJECT_ID; // * // project_name // Field is dictionary from ProjectName // U32 -> ASCII. Has 29 values like: "ARALL", "BARCODE", etc extern column < ascii > zip_encoding PROJECT_NAME; // * // primer_code // Field is dictionary from PrimerCode // U32 -> ASCII. Has 95K values like: "M13 FORWARD", etc extern column < ascii > zip_encoding PRIMER_CODE; // * // taxid // Field is dictionary from TaxonomyTree // U32 -> ASCII. Has 4K values like: "Bacteria", "Pelobacter", etc extern column < ascii > zip_encoding TAXID; // * // anonymized_id // Field is dictionary from AnonymizedId // U32 -> ASCII. Has 15M values like: 10685146475, 10690251308, etc extern column < ascii > zip_encoding ANONYMIZED_ID; // * // reference_set_max extern column < U32 > izip_encoding REFERENCE_SET_MAX; // * // reference_set_min extern column < U32 > izip_encoding REFERENCE_SET_MIN; // * // organism_name // Field is dictionary from OrganismName // U32 -> ASCII. Has 170K names like: "THUNNUS ATLANTICUS", etc extern column < ascii > zip_encoding ORGANISM_NAME; /* INSDC:tbl:sequence inherited virtual productions * bool cs_native; * virtual in_cs_key = 0; * INSDC:dna:text out_cs_key; * virtual out_signal = 0; ## * INSDC:dna:text in_dna_text; * INSDC:2cs:bin out_2cs_bin; * INSDC:2na:bin out_2na_bin; * INSDC:4na:bin out_4na_bin; * INSDC:dna:text out_dna_text; * INSDC:x2cs:bin out_x2cs_bin; * INSDC:x2na:bin out_x2na_bin; * virtual in_color_text = 0; * INSDC:2cs:packed out_2cs_packed; * INSDC:2na:packed out_2na_packed; * INSDC:4na:packed out_4na_packed; * INSDC:color:text out_color_text; * INSDC:quality:phred out_qual_phred; * U8 out_color_matrix; * virtual out_qual_text_phred_33 = 0; * virtual out_qual_text_phred_64 = 0; */ /* INSDC:SRA:tbl:spotcoord inherited virtual productions * INSDC:coord:val out_x_coord; * INSDC:coord:val out_y_coord; */ /* INSDC:SRA:tbl:spotname inherited virtual productions * ascii out_name_fmt; * ascii out_spot_name; * INSDC:SRA:spot_ids_found spot_ids_found; */ /* INSDC:SRA:tbl:spotdesc inherited virtual productions * virtual trim_len = 0; ## * ascii out_label; * U8 out_nreads; * virtual trim_start = 0; ## * INSDC:coord:len out_read_len; * INSDC:coord:len out_label_len; * INSDC:SRA:read_filter out_rd_filter; * INSDC:SRA:xread_type out_read_type; * virtual align_spot_len = 0; * INSDC:coord:zero out_read_start; * INSDC:coord:zero out_label_start; * virtual _alt_in_read_len = 0; * virtual _alt_in_read_type = 0; * INSDC:coord:len base_space_spot_len; * virtual color_space_spot_len = 0; * virtual static_fixed_spot_len = 0; * INSDC:coord:len base_space_fixed_spot_len; * virtual color_space_fixed_spot_len = 0; */ /* INSDC:SRA:tbl:stats inherited virtual productions * U64 base_count; * U64 spot_count; * INSDC:SRA:spotid_t max_spot_id; * INSDC:SRA:spotid_t min_spot_id; * U8 in_stats_bin; * U64 bio_base_count; * U64 cmp_base_count; */ /* INSDC:SRA:tbl:sra inherited virtual productions * INSDC:SRA:platform_id out_platform; * ascii platform_name; * virtual out_spot_group = 0; ## ? */ /* NCBI:tbl:dcmp_base_space inherited virtual productions * virtual out_dcmp_2na_bin = 0; * virtual out_dcmp_4na_bin = 0; * virtual out_dcmp_x2na_bin = 0; * virtual out_dcmp_2na_packed = 0; */ /* NCBI:tbl:base_space_common inherited virtual productions * virtual .CS_KEY = 0; */ /* NCBI:SRA:tbl:spotcoord inherited virtual productions * virtual in_l_coord = 0; ## these could ONLY be needed if * virtual in_t_coord = 0; # we have coordinates in the name * virtual in_x_coord = 0; # and if we parse and store the name * virtual in_y_coord = 0; * INSDC:coord:val in_name_l_coord; * INSDC:coord:val in_name_t_coord; * INSDC:coord:val in_name_x_coord; * INSDC:coord:val in_name_y_coord; */ /* NCBI:SRA:tbl:skeyname inherited virtual productions * virtual in_spot_name_tok = 0; */ /* NCBI:SRA:tbl:stats inherited virtual productions * virtual in_spot_len = 0; * INSDC:quality:phred in_qual_phred; * INSDC:quality:phred in_stats_qual; * virtual in_cmp_stats_bin = 0; */ /* NCBI:SRA:tbl:spotdesc_nocol inherited virtual productions * virtual out_read_seg = 0; * virtual out_label_seg = 0; * U32 [ 2 ] out_read_seg32; * U32 [ 2 ] out_label_seg32; */ /* NCBI:SRA:tbl:spotdesc_nophys inherited virtual productions * physical < ascii > zip_encoding #1 .LABEL; * physical < U8 > zip_encoding #1 .NREADS; * physical < INSDC:coord:len > izip_encoding #1 .READ_LEN; * virtual .READ_SEG = 0; * physical < INSDC:coord:len > izip_encoding #1 .LABEL_LEN; * virtual .LABEL_SEG = 0; * physical < INSDC:SRA:read_filter > zip_encoding #1 .RD_FILTER; * physical < INSDC:SRA:xread_type > zip_encoding #1 .READ_TYPE; * physical < INSDC:coord:zero > izip_encoding #1 .READ_START; * physical < INSDC:coord:zero > izip_encoding #1 .LABEL_START; */ /* NCBI:SRA:tbl:sra_nopos inherited virtual productions * virtual out_position = 0; ## */ } database NCBI:sra:db:trace #1 { table NCBI:sra:tbl:trace #1 SEQUENCE; }